Appendix 1. EEE Virus Testing for for Mosquito Pools (Real-Time RT-PCR)

Before conducting any EEE virus testing, note:

EEE virus is an HHS Select Agent, and therefore, subject to strict regulations regarding its possession and use. Those intending to conduct EEE virus testing must be familiar with the complete information and specific guidance found at the Federal Select Agent Program website before conducting EEE virus testing.

Briefly, samples determined to be positive for EEE virus must be documented and reported to the Federal Select Agent Program via Form 4 (https://www.selectagents.gov/form4.html) within 7 calendar days of identification, and, if not diagnosed at a registered entity, they must then be transferred to a registered Select Agent facility or destroyed.

Testing Algorithm. All samples are screened for virus using either or both sets of the primers/probes listed below. A positive result in any of the negative controls invalidates the entire run. Failure of the positive control to generate a positive result also invalidates the entire run. A sample that is positive with one primer set and negative with the second set is classified as equivocal.

Note: At the CDC, Division of Vector-borne Diseases, Arboviral Disease Branch, the kits and protocols used by the Entomology and Ecology team are described below; however, there are several other options for RNA extraction and real-time RT-PCR on the market.

Results Interpretation

We use the following algorithm to evaluate the results.

Positive:                               Ct value ≤ 37

Negative:                            Ct value > 37

PCR PLATE SET-UP:

1. Prepare primers and probes according to the following concentrations:
   • Primers: 100 µM in nuclease-free water
   • Probes: 25 µM in TE buffer
2. Real-time RT-PCR master mix should be prepared in a “clean room” physically separated from all other laboratory activities with dedicated reagents and equipment (i.e., pipettes). Combine the reagents listed below in an RNase free centrifuge tube on ice. Using Qiagen’s Quantitect Probe RT-PCR kit (#204443), prepare master mix as follows:Per reaction:

• • 0 µl master-mix
  • 2 µl water* (nuclease-free)
  • 5 µl 100µM forward primer
  • 5 µl 100µM reverse primer
  • 3 µl 25µM probe
  • 5 µl RT enzyme
    Add about 5-10 reactions to your total number of samples (and account for “No template controls” (NTCs), positive controls, and negative extraction controls) and multiply number by volumes above.Example: You have 20 samples (12 unknown samples, 2 positive controls, 2 negative controls, and 4 NTCs). Make a master mix for 25 to 30 samples.
  • NTC = mix ONLY with no sample, to test mix components (PCR control)
  • Negative control = extracted water (extraction control)

3. Pipette 45 µl of master mix* into either 0.2 ml optical (specifically for real-time assays; emission fluorescence is read through the cap) PCR tubes or a 96-well optical PCR plate. Use a reservoir and a multichannel pipette for many wells.
4. Pipette 5 µl of RNA* into each well. Refer to a template to ensure that the proper sample is added to the corresponding well. Do not add anything to NTC samples (master mix only).
   • See RNA extraction tips below.

*The volume of RNA added per reaction is typically 5 µl but can be increased (up to 25 µl) with the appropriate adjustment of the water in the master mix. For example, if you want to test 10 µl RNA, reduce the water per reaction to 13.2 µl, and add 40 µl master mix and 10 µl RNA to each well.

Cycling conditions (QIAGEN conditions for Real Time RT-PCR):

1 cycle each:

50°C for 30 min

95°C for 15 min

45 cycles:

95°C for 15 sec

60°C for 1 min (data collection step)

 

EEEV primers and probes. There are one published and one unpublished primer/probe sets available for the detection of EEEV RNA.

Published: Lambert et al. 2003.

EEEV 9391 F                       ACACCGCACCCTGATTTTACA

EEEV 9459 R                       CTTCCAAGTGACCTGGTCGTC

EEEV 9414-probe              TGCACCCGGACCATCCGACCT

 

(unpublished)

EEEV 1898 F                              ACCTTGCTGACGACCAGGTC

EEEV 1968 R                              GTTGTTGGTCGCTCAATCCA

EEEV 1919-probe                    CTTGGAAGTGATGCAAATCCACTCGACA

Rna Extraction Tips

NOTES: Avoid contamination while working with RNA

• Maintain physically separated work areas; one dedicated to pre-amplification RNA work (RNA extraction) and the other for master mix production.
• Utilize dedicated/separate equipment within pre and post amplification areas; especially pipettes and centrifuges.
• Always wear gloves; even when handling unopened tubes.
• Open and close tubes quickly and avoid touching any inside portion.
• Use RNase free plastic disposable tubes and pipet tips.
• Use aerosol block pipet tips.
• Use RNase free water.
• Prepare all reagents on ice.

1. Solid phase samples (mosquitoes or tissues) are first homogenized in an isotonic buffer to produce a liquid homogenate. Mosquito specimens are homogenized using copper clad steel bead (BB) grinding technique using a vortexer or mixer mill (i.e., Qiagen Tissuelyser). Homogenates are clarified by centrifugation in a microcentrifuge (i.e., Eppendorf) at maximum speed for 5 minutes to pellet any particulate material.
2. Extract RNA from the clarified supernatant using the QiaAmp viral RNA kit (QIAGEN part #52904) or another comparable kit specifically designed to purify RNA. Follow the manufacturer’s protocol exactly with the following modification for mosquito specimens: include 1 additional wash/centrifugation step with AW1, if using the Qiagen kit. Extract at least two negative controls and two positive controls along with the test specimens. The positive controls should differ in the amount of target RNA present (i.e., a pre-determined high positive and a low positive). Note: The volume of sample extracted can be greater or less than the standard volume stated in the QIAGEN protocol (140 µl) with the appropriate adjustments to all other volumes in the protocol. CDC typically extracts 100 µl.

References

Lambert  AJ, et al. Detection of North American eastern and western equine encephalitis viruses by nucleic acid amplification assays. J. Clin. Microbiol 2003; 41:379-385.