Resources and Protocols

Resources related to identifying Streptococcus pneumoniae and its serotypes or serogroups (small sets of highly related serotypes, for example 9A/9V) are below.

Alternative Multilocus Sequencing Typing Primers for S. pneumoniae

Alternative multilocus sequencing typing (MLST) primers are located about 40 bases upstream of other primers documented for pneumococcal MLST. You can use these primers for obtaining the first few bases of the target sequence.

S. pneumoniae alternative MLST primers:

Real-time PCR Identification of S. pneumoniae

You can achieve PCR detection of S. pneumoniae by amplifying the lytA gene target. Details for real-time PCR:

• Real-time PCR assays pdf icon[1 page] (Updated Feb 2017)
• pneumoniae detectionexcel icon (Updated Feb 2017)

Real-time PCR Deduction of Pneumococcal Serotypes or Serogroups

Twenty-one monoplex real-time PCR assays are currently available for detection of pneumococcal serotypes or serogroups. List of primers/probes and serotypes/groups covered in the assays available below.

• Real-time PCR-serotyping oligonucleotides pdf icon[2 pages]

Similar to the conventional PCR serotyping, specific schemes are available for real-time PCR assays based on geographic prevalence of serotypes. The assays are multiplexed in a sequential triplex format available below separated by geographic area.

• Triplex sequential real time PCR-serotyping Latin America pdf icon[4 pages]
• Triplex sequential real time PCR-serotyping-US pdf icon[4 pages]
• Triplex sequential real time PCR-serotyping Africa pdf icon[4 pages]
• Triplex sequential real time PCR-serotyping Asia pdf icon[4 pages]

Conventional PCR Deduction of 40 Pneumococcal Serotypes or Serogroups

Accurate serotyping is essential for epidemiologic study of S. pneumoniae. CDC devised simple multiplex PCR schemes to reliably deduce specific pneumococcal serotypes from isolate sets and clinical specimens. This PCR approach is highly reliable and has the potential to reduce reliance upon conventional phenotypic serotyping. This system gives serotype-determining potential to any facility that has equipment necessary for DNA amplification and electrophoresis; you do not need typing sera or other reagents.

Below are protocols detailing methods for extraction of DNA from bacterial isolates and clinical specimens for any type of PCR testing:

• Fast Extraction of DNA for Streptococcal Culture Isolates pdf icon[1 page]
• Blood and Body Fluid DNA Extraction for Streptococci pdf icon[2 pages]

Conventional PCR Serotype Deduction Protocols

CDC validates and refines primer sets thoroughly through diverse isolate sets representing individual serotypes. Serospecificities are added and primer sets updated to regularly improve specificity. A current updated primer list (41 serospecificities) is available below.

• Oligonucleotide Primers Used for Deducing 41 Pneumococcal Capsular Serotypes pdf icon[3 pages]

There are 3 important points for using this PCR serotyping scheme:

1. Band sizes must exactly match positive controls before assigning a serotype. Non-specific bands have been occasionally detected when performing multiplex PCR testing on clinical specimens.
2. A negative cpsA control does not necessarily equate to a non-serotypeable isolate or a pneumococcus-negative clinical specimen. The positive pneumococcal control band for cpsA is negative in 1-2% of PCR-serotypeable isolates that have been encountered. This result most often occurs in serotypes 25 and 38, but has been rarely encountered in serotypes 14 and 35A.
3. Using this PCR assay within carriage specimens may result in some inaccuracy depending upon specimen and carriage population. High amounts of amplification of some presumed pneumococcal-specific targets for serotyping from lytA-negative specimens (i.e. presumed not to contain pneumococci) have been found. For example, the six 192 bp sequences directly below correspond to pneumococcal serogroup 10F/10C amplification products (following subtraction of primers).

   >Seq1 [organism =Streptococcus infantis] [strain SS1641] wzx gene, partial CDS
   TAGAATATGCTAGGCATCATTTGAAACCTGTCATCTTATTGTTCCTTCCGCAAGTGGCGA
   TTTCCTTGTATGTAACGCTAGATCGTACCATGCTTGGAGCCTTAGCTTCTACAAAAGATG
   TAGGGATTTATGACCAGGCTCTAAAGTTGGTAAATATCCTTCTGACCTTAGTAACTTCCT
   TGGGAAGTGTTA

   >Seq2 [organism=Streptococcus gordonii] [strain SS1245] wzx gene, partial CDS
   TAGAATATGCTAGGCATCATTTAAAGCCGGTCATATTATTATTCCTTCCTCAAGTAGCTA
   TTTCTTTGTACATTACGCTGGATCGTACCATGCTTGGAGCCTTAGCTTCTACAAAAGATG
   TAGGAATTTATGACCAGGCCCTAAAATTAGTAAATATCCTTCTGACCTTAGTAACTTCCT
   TGGGAAGCGTTA

   >Seq3 [organism=Streptococcus salivarius] [strain SS1061] wzx gene partial CDS
   TAGAATATGCTAGGTATCATTTAAAGCCAGTCATATTATTATTCCTTCCTCAAGTAGCTA
   TTTCTTTGTACATTACGCTGGATCGTACCATGCTTGGAGCCTTAGCTTCTACAAAAGATG
   TAGGGATTTATGACCAGGCCTTAAAATTAGTAAATATCCTTCTGACCTTGGTAACTTCCT
   TGGGAAGCGTTA

   >Seq4 [organism=unknown] [human upper respiratory tract specimen 49] wzx gene, partial CDS
   TAGAATATGCTAGACATCATTTAAAGCCGGTCATATTATTATTCCTTCCTCAAGTAGCTA
   TTTCTTTATACATTACGCTGGATCGTACCATGCTTGGAGCCTTAGCTTCTACAAAAGATG
   TAGGGATTTATGACCAGGCCCTAAAATTAGTAAATATCCTTCTGACCTTGGTAACTTCCT
   TGGGAAGCGTTA

   >Seq5 [organism=unknown] [human upper respiratory tract specimen 248] wzx gene, partial CDS
   TAGAATATGCTAGACATCATTTAAAGCCGGTCATATTATTATTCCTTCCTCAAGTAGCTA
   TTTCTTTGTACATTACGCTGGATCGTACCATGCTTGGAGCCTTAGCTTCTACAAAAGATG
   TAGGGATTTATGACCAGGCCCTAAAATTAGTAAATATCCTTCTGACCTTGGTAACTTCCT
   TGGGAAGCGTTA

   >Seq6 [organism=unknown] [human upper respiratory tract specimen 300] wzx gene, partial CDS
   TAGAATATGCTAGACATCATTTAAAGCCGGTCATATTATTATTCCTTCCTCAAGTAGCTA
   TTTCTTTGTACATTACGCTGGATCGTACCATGCTTGGAGCCTTAGCTTCTACAAAAGATG
   TAGGAATTTATGACCAGGCTCTAAAATTGGTAAATATCCTTCTGACCTTGGTAACTTCCT
   TGGGAAGCGTTA

These sequences were found in non-pneumococcal species and/or lytA-negative carriage specimens. Additional data from upper respiratory tract specimens have demonstrated non-pneumococcal homologs of additional serogroups and serotypes.^1,2

Multiplex Conventional PCR Schemes for Pneumococcal Serotype Deduction

The following sequential PCR scheme, based on geographic serotype distribution, is useful for determining pneumococcal serotypes in a multiplex format. Make sure band sizes exactly match positive controls before assigning a serotype. Occasionally non-specific bands have been detected when using multiplex PCR to test clinical specimens.

• U.S. scheme pdf icon[5 pages]
• Latin America scheme pdf icon[5 pages]
• Africa scheme pdf icon[5 pages]

Pneumococcal Carriage Protocols

Detailed protocols for specimen collection, processing, and storage of nasopharyngeal swabs for pneumococcal carriage studies are provided below.

• Identification and Serotyping of Pneumococci from Carriage pdf icon[1 page]
• Streptococcus pneumoniae Carriage Study Protocol ‐ Nasopharyngeal (NP) Swab Processing pdf icon[3 pages]

Footnotes

1Carvalho MG, Bigogo GM, Junghae M, et al. Potential non-pneumococcal confounding of PCR-based determination of serotype in carriageexternal icon. J Clin Microbiol. 2012;50(9):3146–7.

²Carvalho Mda G, Pimenta FC, et al. Non-pneumococcal mitis-group streptococci confound detection of pneumococcal capsular serotype-specific loci in upper respiratory tractexternal icon. PeerJ. 2013;1:e97.