Resources and Protocols

On This Page

Alternative Multilocus Sequencing Typing Primers for S. pneumoniae
Real Time PCR Identification of S. pneumoniae
Pneumococcal Carriage Protocols

Resources related to identifying Streptococcus pneumoniae and its serotypes or serogroups (small sets of highly related serotypes, for example 9A/9V) are below.

Alternative Multilocus Sequencing Typing (MLST) Primers for S. pneumoniae

Alternative MLST primers are located about 40 bases upstream of other primers documented for pneumococcal MLST. You can use these primers for obtaining the first few bases of the target sequence.

S. pneumoniae alternative MLST primers:

aroE-fwd TCCTATTAAGCATTCTATTTCTCCCTTC
aroE-rev ACAGGAGAGGATTGGCCATCCATGCCCACACTG

recA-fwd GAATGTGTGATTCAATAATCACCTCAAATAGAAGG
recA-rev TGCTGTTTCGATAGCAGCATGGATGGCTTCC

spi-fwd CGCTTAGAAAGGTAAGTTATGAATTT
spi-rev GAAGAGGCTGAGATTGGTGATTCTCGGCC

xpt-fwd TTAACTTTTAGACTTTAGGAGGTCTTATG
xpt-rev CGGCTGCTTGCGAGTGTTTTTCTTGAG

ddl-fwd TAAAATCACGACTAAGCGTGTTCTGG
ddl-rev AAGTAGTGGGTACATAGACCACTGGG

Real-time PCR Identification of S. pneumoniae

You can achieve PCR detection of S. pneumoniae by amplifying the lytA gene target. Details for real-time PCR:

Oligonucleotides used in the Singleplex Real-time PCR assays for identification of Streptococcal species (Updated June 2021)
Singleplex real time PCR method for S. pneumoniae detection (Updated June 2021)
Oligonucleotides used in the triplex real-time PCR assays for identification of S. pneumoniae, N. meningitidis and H. influenzae (Updated June 2021)
Triplex real time PCR method for S. pneumoniae, N. meningitidis and H. influenzae identification (Updated June 2021)

PCR based methods for identification of S. pneumoniae serotypes/serogroups

Accurate serotyping is essential for epidemiologic study of S. pneumoniae. CDC devised simple multiplex PCR schemes to reliably deduce specific pneumococcal serotypes from isolate sets and sterile site clinical specimens. This PCR approach is highly reliable and has the potential to reduce reliance upon conventional phenotypic serotyping. This system gives serotype-determining potential to any facility that has equipment necessary for DNA amplification and electrophoresis; you do not need typing sera or other reagents.

Caution should be taken when using PCR-based approaches for serotyping from upper respiratory specimens, in particular oropharyngeal swabs. The recovery of capsular polysaccharide biosynthetic operon (cps) sequences, thought to be solely associated with pneumococcal serotypes, within related nonpneumococcal commensal strains such as S. mitis and S. oralis, may result in some inaccuracy depending upon specimen and carriage population^1-6.

Below are protocols detailing methods for extraction of DNA from bacterial isolates and clinical specimens for any type of PCR testing:

I. Real-time PCR Deduction of Pneumococcal Serotypes or Serogroups

a. Quadriplex real-time PCR identification of pneumococcal serotypes/serogroups

Forty-eight real-time PCR assays in 12 quadriplex reactions are available for detection of 64 serotypes as individual serotypes or small serogroups. The list of primers/probes used in the assays are provided below.

Below is the link to download the PCR reaction template sheets for the US-based quadriplex real time PCR scheme. However, this scheme can be used in any geographical location where PCV vaccine has already been introduced. Based on the knowledge of local country serotype prevalence, the order of reactions can be adjusted to target the most abundant serotypes in the first few multiplex reactions.

b. Triplex real time PCR identification of pneumococcal serotypes/serogroups

Twenty-one real-time PCR assays are currently available for detection of pneumococcal serotypes or serogroups. List of primers/probes and serotypes/groups covered in the assays available below.

Triplex Real-time PCR-serotyping oligonucleotides [2 pages]

Similar to the conventional PCR serotyping, specific schemes are available for real-time PCR assays based on geographic prevalence of serotypes. The assays are multiplexed in a sequential triplex format available below separated by geographic area.

II. Conventional PCR Deduction of 40 Pneumococcal Serotypes or Serogroups

a. Conventional PCR Serotype Deduction Protocols

CDC validates and refines primer sets thoroughly through diverse isolate sets representing individual serotypes. Serospecificities are added and primer sets updated to regularly improve specificity. A current updated primer list (41 serospecificities) is available below.

Oligonucleotide Primers Used for Deducing 41 Pneumococcal Capsular Serotypes [3 pages]

There are 3 important points for using this PCR serotyping scheme:

Band sizes must exactly match positive controls before assigning a serotype. Non-specific bands have been occasionally detected when performing multiplex PCR testing on clinical specimens.
A negative cpsA control does not necessarily equate to a non-serotypeable isolate or a pneumococcus-negative clinical specimen. The positive pneumococcal control band for cpsA is negative in 1-2% of PCR-serotypeable isolates that have been encountered. This result most often occurs in serotypes 25 and 38, but has been rarely encountered in serotypes 14 and 35A.
Using this PCR assay within carriage specimens may result in some inaccuracy depending upon specimen and carriage population^1-6. High amounts of amplification of some presumed pneumococcal-specific targets for serotyping from lytA-negative specimens (i.e. presumed not to contain pneumococci) have been found. For example, the six 192 bp sequences directly below correspond to pneumococcal serogroup 10F/10C amplification products (following subtraction of primers).

>Seq1 [organism =Streptococcus infantis] [strain SS1641] wzx gene, partial CDS
TAGAATATGCTAGGCATCATTTGAAACCTGTCATCTTATTGTTCCTTCCGCAAGTGGCGA
TTTCCTTGTATGTAACGCTAGATCGTACCATGCTTGGAGCCTTAGCTTCTACAAAAGATG
TAGGGATTTATGACCAGGCTCTAAAGTTGGTAAATATCCTTCTGACCTTAGTAACTTCCT
TGGGAAGTGTTA

>Seq2 [organism=Streptococcus gordonii] [strain SS1245] wzx gene, partial CDS
TAGAATATGCTAGGCATCATTTAAAGCCGGTCATATTATTATTCCTTCCTCAAGTAGCTA
TTTCTTTGTACATTACGCTGGATCGTACCATGCTTGGAGCCTTAGCTTCTACAAAAGATG
TAGGAATTTATGACCAGGCCCTAAAATTAGTAAATATCCTTCTGACCTTAGTAACTTCCT
TGGGAAGCGTTA

>Seq3 [organism=Streptococcus salivarius] [strain SS1061] wzx gene partial CDS
TAGAATATGCTAGGTATCATTTAAAGCCAGTCATATTATTATTCCTTCCTCAAGTAGCTA
TTTCTTTGTACATTACGCTGGATCGTACCATGCTTGGAGCCTTAGCTTCTACAAAAGATG
TAGGGATTTATGACCAGGCCTTAAAATTAGTAAATATCCTTCTGACCTTGGTAACTTCCT
TGGGAAGCGTTA

>Seq4 [organism=unknown] [human upper respiratory tract specimen 49] wzx gene, partial CDS
TAGAATATGCTAGACATCATTTAAAGCCGGTCATATTATTATTCCTTCCTCAAGTAGCTA
TTTCTTTATACATTACGCTGGATCGTACCATGCTTGGAGCCTTAGCTTCTACAAAAGATG
TAGGGATTTATGACCAGGCCCTAAAATTAGTAAATATCCTTCTGACCTTGGTAACTTCCT
TGGGAAGCGTTA

>Seq5 [organism=unknown] [human upper respiratory tract specimen 248] wzx gene, partial CDS
TAGAATATGCTAGACATCATTTAAAGCCGGTCATATTATTATTCCTTCCTCAAGTAGCTA
TTTCTTTGTACATTACGCTGGATCGTACCATGCTTGGAGCCTTAGCTTCTACAAAAGATG
TAGGGATTTATGACCAGGCCCTAAAATTAGTAAATATCCTTCTGACCTTGGTAACTTCCT
TGGGAAGCGTTA

>Seq6 [organism=unknown] [human upper respiratory tract specimen 300] wzx gene, partial CDS
TAGAATATGCTAGACATCATTTAAAGCCGGTCATATTATTATTCCTTCCTCAAGTAGCTA
TTTCTTTGTACATTACGCTGGATCGTACCATGCTTGGAGCCTTAGCTTCTACAAAAGATG
TAGGAATTTATGACCAGGCTCTAAAATTGGTAAATATCCTTCTGACCTTGGTAACTTCCT
TGGGAAGCGTTA

These sequences were found in non-pneumococcal species and/or lytA-negative carriage specimens. Additional data from upper respiratory tract specimens have demonstrated non-pneumococcal homologs of additional serogroups and serotypes.^1,2

b. Multiplex Conventional PCR Schemes for Pneumococcal Serotype Deduction

The following sequential PCR scheme, based on geographic serotype distribution, is useful for determining pneumococcal serotypes in a multiplex format. Make sure band sizes exactly match positive controls before assigning a serotype. Occasionally non-specific bands have been detected when using multiplex PCR to test clinical specimens.

Multiplex real time PCR identification of antimicrobial resistance (AMR) determinants and Pili genes

The protocols provided below can be used to identify key antibiotic resistance determinants [including pbp2B (penicillin susceptibility), tetM (tetracycline resistance), ermB (erythromycin and clindamycin resistance), mef (erythromycin resistance), and cat (chloramphenicol resistance)] and two virulence factor genes (Pilus 1 and 2).

Pneumococcal Carriage Protocols

Detailed protocols for specimen collection, processing, and storage of nasopharyngeal swabs for pneumococcal carriage studies are provided below.

Footnotes

1Carvalho MG, Bigogo GM, Junghae M, et al. Potential non-pneumococcal confounding of PCR-based determination of serotype in carriage. J Clin Microbiol. 2012;50(9):3146–7.

²Carvalho Mda G, Pimenta FC, et al. Non-pneumococcal mitis-group streptococci confound detection of pneumococcal capsular serotype-specific loci in upper respiratory tract. PeerJ. 2013;1:e97.

³Lessa FC, Milucky J, Rouphael NG, et al. Streptococcus mitis Expressing Pneumococcal Serotype 1 Capsule. Sci Rep. 2018; 8(1):17959.

⁴Pimenta F, Gertz RE Jr, Park SH, et al. Streptococcus infantis, Streptococcus mitis, and Streptococcus oralis Strains With Highly Similar cps5 Loci and Antigenic Relatedness to Serotype 5 Pneumococci. Front Microbiol. 2019; 8;9:3199.

⁵Beall B. Potential Epidemiologic and Historical Implications of Capsular Serotypes Shared by Pneumococci and Their Nonpneumococcal Relatives. J Infect Dis. 2020;222(3):343-346.

⁶Gertz RE Jr, Pimenta FC, Chochua S, et al. Nonpneumococcal Strains Recently Recovered from Carriage Specimens and Expressing Capsular Serotypes Highly Related or Identical to Pneumococcal Serotypes 2, 4, 9A, 13, and 23A. mBio . 2021 12(3):e01037-21.

Top of Page