Streptococcus pneumoniae Detection and Serotyping Using PCR

For Public Health

Key points

  • Accurate detection and serotyping are essential for epidemiologic study of Streptococcus pneumoniae (pneumococcus).
  • CDC provides multiple resources to detect the bacteria and identify serotypes using polymerase chain reaction (PCR) methods.
  • This page also includes resources on identifying antimicrobial resistance (AMR) determinants and virulence factor genes by PCR.
Graphic of laboratory equipment

Overview

S. pneumoniae are classified into more than 100 serotypes. Small sets of highly related serotypes are called serogroups.

CDC has devised schemes to reliably deduce specific pneumococcal serotypes from isolate sets and sterile site clinical specimens using:

  • Real-time PCR
  • Conventional PCR

Advantages

These PCR approaches

  • Are highly reliable
  • Could reduce reliance upon conventional phenotypic serotyping
  • Give serotype-determining potential to more facilities

Laboratories only need equipment necessary for DNA amplification and electrophoresis, not typing sera or other reagents.

Disadvantages

Take caution when using PCR-based approaches for serotyping from upper respiratory specimens, in particular oropharyngeal swabs.

Capsular polysaccharide biosynthetic operon (cps) sequences were thought to be solely associated with pneumococcal serotypes. However, they've been recovered within related nonpneumococcal commensal strains like S. mitis and S. oralis. Thus, PCR-based approaches may result in some inaccurate results depending upon specimen and carriage population123456.

Read more about this concern below.

Real-time PCR

Detecting pneumococcus

Amplify the lytA gene target to detect S. pneumoniae by real-time PCR. View a list of primer and probe sequences:

Deducing serotype or serogroup

The prior triplex pneumococcal serotyping scheme was updated to 48 real-time PCR assays in 12 quadriplex reactions. This allows for detection of 64 serotypes as individual serotypes or small serogroups7. For updates to the assay, contact StrepLab@cdc.gov.

Quadriplex assays

Identifying AMR determinants and virulence factor genes

Use the following real-time PCR assays to identify key antibiotic resistance determinants7 including

  • pbp2B (penicillin susceptibility)
  • tetM (tetracycline resistance)
  • ermB (erythromycin and clindamycin resistance)
  • mef (erythromycin resistance)
  • cat (chloramphenicol resistance)

The assays can also identify two virulence factor genes7:

  • Pilus 1
  • Pilus 2

Multiplex targets (pneumococcal AMR and pili genes)

Have questions?

CDC's Streptococcus Laboratory can provide additional information, including on sequential multiplex serotyping schemes and protocols.

Conventional PCR

Deducing serotypes

Laboratories can also use conventional multiplex PCR deduction for 41 serospecificities.

CDC has primer sets thoroughly validated through diverse isolate sets representing individual serotypes.

Importance of matching band sizes

Band sizes must exactly match positive controls before assigning a serotype. Non-specific bands have been occasionally detected when performing multiplex PCR testing on clinical specimens.

Meaning of a negative cpsA control

A negative cpsA control doesn't necessarily equate to a non-serotypeable isolate or a pneumococcus-negative clinical specimen.

CDC's Streptococcus Laboratory has found that the positive pneumococcal control band for cpsA is negative in 1-2% of PCR-serotypeable isolates encountered. This result most often occurs in serotypes 25 and 38, but has been rarely encountered in serotypes 14 and 35A.

Inaccuracy possible within carriage specimens

Using this PCR assay within carriage specimens may result in some inaccuracy depending upon specimen and carriage population123456.

Multiplex schemes

The set of conventional PCR serotyping assays can be used in several sequential PCR schemes based on geographic serotype distribution. For additional information on the sequential multiplex serotyping schemes and protocols, contact StrepLab@cdc.gov.

Extraction protocols

The following protocols detail methods to extract DNA from bacterial isolates and clinical specimens for any type of PCR testing:

Alternative multilocus sequencing typing primers

Alternative multilocus sequencing typing (MLST) primers are located about 40 bases upstream of other primers documented for pneumococcal MLST. Use these primers to obtain the first few bases of the target sequence.

View MLST primers for S. pneumoniae.

Inaccuracy concerns related to carriage specimens

lytA-negative specimens are presumed to not contain pneumococci. However, high amounts of amplification of some pneumococcal-specific serotyping targets have been found in lytA-negative specimens.

For example, the six 192 bp sequences directly below correspond to pneumococcal serogroup 10F/10C amplification products (following subtraction of primers):

>Seq1 [organism =Streptococcus infantis] [strain SS1641] wzx gene, partial CDS TAGAATATGCTAGGCATCATTTGAAACCTGTC
ATCTTATTGTTCCTTCCGCAAGTGGCGATTTC
CTTGTATGTAACGCTAGATCGTACCATGCTTG
GAGCCTTAGCTTCTACAAAAGATGTAGGGATT
TATGACCAGGCTCTAAAGTTGGTAAATATCCT
TCTGACCTTAGTAACTTCCTTGGGAAGTGTTA

>Seq2 [organism=Streptococcus gordonii] [strain SS1245] wzx gene, partial CDS TAGAATATGCTAGGCATCATTTAAAGCCGGTC
ATATTATTATTCCTTCCTCAAGTAGCTATTTCT
TTGTACATTACGCTGGATCGTACCATGCTTGG
AGCCTTAGCTTCTACAAAAGATGTAGGAATTT
ATGACCAGGCCCTAAAATTAGTAAATATCCTT
CTGACCTTAGTAACTTCCTTGGGAAGCGTTA

>Seq3 [organism=Streptococcus salivarius] [strain SS1061] wzx gene partial CDS TAGAATATGCTAGGTATCATTTAAAGCCAGTC
ATATTATTATTCCTTCCTCAAGTAGCTATTTCT
TTGTACATTACGCTGGATCGTACCATGCTTGG
AGCCTTAGCTTCTACAAAAGATGTAGGGATTT
ATGACCAGGCCTTAAAATTAGTAAATATCCTT
CTGACCTTGGTAACTTCCTTGGGAAGCGTTA

>Seq4 [organism=unknown] [human upper respiratory tract specimen 49] wzx gene, partial CDS TAGAATATGCTAGACATCATTTAAAGCCGGTC
ATATTATTATTCCTTCCTCAAGTAGCTATTTCT
TTATACATTACGCTGGATCGTACCATGCTTGG
AGCCTTAGCTTCTACAAAAGATGTAGGGATTT
ATGACCAGGCCCTAAAATTAGTAAATATCCTT
CTGACCTTGGTAACTTCCTTGGGAAGCGTTA

>Seq5 [organism=unknown] [human upper respiratory tract specimen 248] wzx gene, partial CDS TAGAATATGCTAGACATCATTTAAAGCCGGTC
ATATTATTATTCCTTCCTCAAGTAGCTATTTCT
TTGTACATTACGCTGGATCGTACCATGCTTGG
AGCCTTAGCTTCTACAAAAGATGTAGGGATTT
ATGACCAGGCCCTAAAATTAGTAAATATCCTT
CTGACCTTGGTAACTTCCTTGGGAAGCGTTA

>Seq6 [organism=unknown] [human upper respiratory tract specimen 300] wzx gene, partial CDS TAGAATATGCTAGACATCATTTAAAGCCGGTC
ATATTATTATTCCTTCCTCAAGTAGCTATTTCT
TTGTACATTACGCTGGATCGTACCATGCTTGG
AGCCTTAGCTTCTACAAAAGATGTAGGAATTT
ATGACCAGGCTCTAAAATTGGTAAATATCCTT
CTGACCTTGGTAACTTCCTTGGGAAGCGTTA

These sequences were found in non-pneumococcal species or lytA-negative carriage specimens. Additional data from upper respiratory tract specimens have demonstrated non-pneumococcal homologs of additional serogroups and serotypes12.