Resources and Protocols

The M protein gene (emm) encodes the cell surface M virulence protein; scientists have described at least 100 Streptococcus pyogenes M serotypes based on the M protein structure. emm typing is based on sequence analysis of the portion of the emm gene that dictates the M serotype. The hypervariable sequence associated with M serospecificity is adjacent to one of the amplifying primer sequences, allowing for direct sequencing.

Resources related to assigning emm types and subtypes, global distribution, typing protocol, and identification methods are below.

emm­ Designations and Clusters

Contact Us

CDC requests sequences that are different types or subtypes from the ones in this database. Please submit text files of any new emm sequence types or subtypes.

emm Types as Proportions of Total Disease Isolates in Six Global Regions

emm sequence typing is the most widely used method for identifying S. pyogenes strains and has been used to characterize isolates in all regions of the world. View data on six global regions.2

emm Typing Protocol

I. Real time PCR identification of emm types

Real time PCR method for the identification of top 20 emm types of GAS in the USA are currently available3. List of oligonucleotides and reaction sheets are provided below:

II. Conventional PCR and sequencing method

When assigning emm types, it is important to use sequences immediately adjacent to primer 1. These sequences are usually linked to M protein family genes rather than emm-like mrp or enn genes. View the detailed protocol for emm typing.

For determining emm subtype using a whole-genome sequence-based approach, CDC uses a de novo assembly. This helps to avoid confounding of this 180 base segment by the similar emm-like mrp and enn sequences (see CDC Streptococcus Laboratory GAS bioinformatic pipeline for S. pyogenes).

Alternative Multilocus Sequencing Typing (MLST) Primers

Alternative MLST primers for Sanger sequencing generally lie about 40 bases further upstream than other primers documented for group A Streptococcus MLST. These primers are better for obtaining the first few bases of the target sequence.

gkigas-fwd Length: 24 1 gctgattttgtgggaattggtatg
gkigas-rev Length: 23 1 gtgagcgtagaaattctcctgct

gtr-fwd Length: 26 1 ggaattgatttagacattatgccagg
gtr-rev Length: 22 1 cacaataacgccgccatccata

recpgas-fwd Length: 22 1 tgtccgcaccctatcaatggat
recgas-rev Length: 24 1 catctttcacaaggatatgttgcc

xptgas-fwd Length: 29 1 atgcagttacttgaagaacgcatcttaac
xptgas-rev Length: 24 1 gcctccaagaagtttagattacca

yqi-fwd Length: 27 1 cttttgcaggttatcacatgggtataa
yqi-rev Length: 27 1 aagcaatagctcctccattg acattaa

muri-fwd Length: 28 1 ctatggtcctagacccaaaaaacaaatt
muri-rev Length: 25 1 ggatttgctgttgtaaaaaagcggt

muts-fwd Length: 22 1 aggtcagatgttagaggctagg
muts-rev Length: 27 1. cccagttcatcaaatagaataagagag

Real Time PCR Identification of Streptococcus pyogenes

You can use a molecular approach using real-time PCR assay targeting the spy gene for detecting S. pyogenes. Primer/probe sequences for PCR:


1 Sanderson-Smith M, De Oliveira DM, Guglielmini J, et al. A systematic and functional classification of Streptococcus pyogenes that serves as a new tool for molecular typing and vaccine development. J Infect Dis. 2014;210(8):1325–38.

2 Steer AC, I Law, L. Matatolu, BW Beall, JR Carapetis. Global emm type distribution of group A streptococci: Systematic review and implications for vaccine development. Lancet Infect Dis. 2009;9:611–6

3 Velusamy S, Jordak K, Kupor M, Chochua S, McGee L, Beall B. Sequential Quadriplex Real-Time PCR for Identifying 20 Common emm Types of Group A Streptococcus. J Clin Microbiol. 2021; 59(1):e01764-20.