Protocol for emm typing

Related Pages

I. Lysate preparation (other manual or automated DNA extraction methods acceptable)

(Note that one can often simply boil very fresh growth from pure isolates with good results for DNA extracts).

1. DNAzol extraction of DNA

1.1 Aliquot 50 µl of DNAzol per sample in tubes or in 96 well plate. Add 10 µL of STGG frozen culture (health, pure) or 1 µL loopful of bacterial colonies from fresh culture. Seal plate or tube.

1.2  Vortex gently for 1 – 3 sec.

1.3  Incubate at 80°C for 20 min.

1.4  Proceed with PCR or store the DNA at -20°C, no heat inactivation required.

Note: Recommended to use 2 µL of template DNA for PCR.

2. Alternate protocol

2.1 Pick fair amount 1/5 of fresh bacterial growth from the plate with standard loop (10 µL). Resuspend in 300 µL of 0.85% NaCl.

2.2 Incubate at 70°C for 15 min.

2.3 Centrifuge the samples at full speed for 2 min in microfuge and pipet out supernatant.

2.4 Resuspend pellet in 50 µL TE (10mM Tris, 1mM EDTA, pH8), 10 µL Mutanolysin (3,000 U/mL), and 2 µL Hyaluronidase (30 mg/mL, Sigma H-3506; 300-750 U/mg).

2.5 Vortex thoroughly and incubate at 37°C for 30 min.

2.6 Then Incubate at 100°C for 10 min to inactivate the enzymes.

2.7 Proceed with PCR or store the lysates at -20°C until use.

Top of Page

II. Conventional PCR amplification and sequencing of emm genes

PCR Primers

PCR Primers
Primer 1 TATT(C/G)GCTTAGAAAATTAA
Primer 2 GCAAGTTCTTCAGCTTGTTT

PCR Master Mix

PCR Master Mix table 1
Reagents per Reaction
10X buffer (with 15 mM MgCl2) 2.5 µL
dNTPs (10 mM) 0.5 µL
Primer 1 (70 pM/µL) 0.5 µL
Primer 2 (70 pM/µL) 0.5 µL
Taq Polymerase (3 U/µL) 0.18 µL
dH2O 19.82 µL
Total 24 µL
  1. Spin down lysate at full speed for 1 min.
  2. For each sample, aliquot 24 µL master mix in PCR tubes/plate.
  3. Add no more than 1.0 µL lysate supernatant – vortex gently – centrifuge for few seconds to collect reaction mix at the bottom of the PCR tube/plate.
  4. Place the PCR reaction tubes/plate on thermocycler under the following conditions.

Note: Place the PCR plate on thermocycler only after the initial sample temperature (94°C) is reached.

PCR Master Mix table 2
94°C 1 min 1 cycle
94°C 15 sec 10 cycles
47°C 30 sec 10 cycles
72°C 1 min 15 sec 10 cycles
94°C 15 sec 20 cycles
47°C 30 sec 20 cycles
72°C 1 min 15 sec with a 10 sec increment
for each of the subsequent 19 cycles		 20 cycles
72°C 7 min 1 cycle
4°C Hold Hold

III. Sequencing

1. Purification of PCR reaction for sequencing

Prepare sequencing template from 2-11 µL aliquot of PCR product to be sequenced with ExoSAP-IT as follows:

Purification of PCR reaction for sequencing table 1
PCR product 5 µL
ExoSAP-IT 2 µL
Total 7 µL

Mix and incubate in a thermocycler using following conditions:

Purification of PCR reaction for sequencing table 2
37°C 15 min
80°C 15 min

2. Sequence reaction

Sequencing primer: emmseq2 – TATTCGCTTAGAAAATTAAAAACAGG
Dilute BigDye V1.1 to 1:5 with the buffer provided with the kit.

Sequence reaction table 1
Primer emm seq2 (3.2 pmole/µL) 1 µL
Diluted BigDyeV1.1 (1:5) 6 µL
dH2O 12 µL
Purified PCR product 1 µL
Total 20 µL

For sequencing reaction, use the following cycling parameters:

Sequence reaction table 2
96°C 1 min
96°C 10 sec 25 Cycles
55°C 5 sec 25 Cycles
60°C 4 min 25 Cycles
4°C Hold

Store the sequencing reactions at -20°C until use.

For consultation contact: GASemmtyping@cdc.gov

Top of Page