Skip directly to search Skip directly to A to Z list Skip directly to navigation Skip directly to site content Skip directly to page options
CDC Home

Alternative MLST Primers for S. pyogenes and S. pneumoniae

Alternative MLST primers. We have found that the primers listed at www.mlst.net often lie to close for accurate sequencing results for the first 10-40 bases of the target using our capillary sequencers. We have found these alternative primers useful. These generally lie about 40 bases further upstream and downstream of the target sequences than the ones described at www.mlst.net.

S. pneumoniae alternative MLST primers.

aroE-fwd TCCTATTAAGCATTCTATTTCTCCCTTC
aroE-rev ACAGGAGAGGATTGGCCATCCATGCCCACACTG

recA-fwd GAATGTGTGATTCAATAATCACCTCAAATAGAAGG
recA-rev TGCTGTTTCGATAGCAGCATGGATGGCTTCC

spi-fwd CGCTTAGAAAGGTAAGTTATGAATTT
spi-rev GAAGAGGCTGAGATTGGTGATTCTCGGCC

xpt-fwd TTAACTTTTAGACTTTAGGAGGTCTTATG
xpt-rev CGGCTGCTTGCGAGTGTTTTTCTTGAG

ddl-fwd TAAAATCACGACTAAGCGTGTTCTGG
ddl-rev AAGTAGTGGGTACATAGACCACTGGG

S. pyogenes alternative MLST primers

gkigas-fwd Length: 24 1 gctgattttgtgggaattggtatg
gkigas-rev Length: 23 1 gtgagcgtagaaattctcctgct

gtr-fwd Length: 26 1 ggaattgatttagacattatgccagg
gtr-rev Length: 22 1 cacaataacgccgccatccata

recpgas-fwd Length: 22 1 tgtccgcaccctatcaatggat
recgas-rev Length: 24 1 catctttcacaaggatatgttgcc

xptgas-fwd Length: 29 1 atgcagttacttgaagaacgcatcttaac
xptgas-rev Length: 24 1 gcctccaagaagtttagattacca

yqi-fwd Length: 27 1 cttttgcaggttatcacatgggtataa
yqi-rev Length: 27 1 aagcaatagctcctccattg acattaa

muri-fwd Length: 28 1 ctatggtcctagacccaaaaaacaaatt
muri-rev Length: 25 1 ggatttgctgttgtaaaaaagcggt

muts-fwd Length: 22 1 aggtcagatgttagaggctagg
muts-rev Length: 27 1. cccagttcatcaaatagaataagagag

Primers for Streptococcus dysgalactiae subsp. equisimilis and Streptococcus canis MLST.

Note that all primers, with the exception of yqiZ, target genes corresponding to the S. pyogenes MLST scheme described at http://spyogenes.mlst.net/.

Primer name sequence amplicon
length (bp)

gki-fwd
gki-rev

GCAGATTTTATTGGTATCGGTATGG
GTGAACGTAAGAATTCTCCTGCTG

498

gtr-fwd
gtr-rev

GGAATTGATTTAAACATTATGTCAGGAG
CACAATAACGCCGCCATCCATA

450

murI-fwd
murI-rev

TTATGGTCCAAGACCTGCTGAGC
TTTCAGGACTTGCCGTTGTGTAAAA

438

mutS-fwd
mutS-rev

AGGTCAGATGTTAGAGGCTAGG
CCTAGTTCATCAAATAGAATAAGGGAA

405

recP-fwd
recP-rev

TGTCCGCACCCTATCAATGGAT
CATCTTTCACAAGGATATGTTGCC

459

xpt-fwd
xpt-rev

ATGCAGTTACTTGAAGAACGCATCTTAAC
GCCTCCAAGAAGTTTAGATTACCA

450

yqiZ-fwd
yqiZ-rev

CAGATGCTTTTAACAATTACCACATGG
CCCATTCACATTCACGATTTCTGG

434

Top of Page

 

Images and logos on this website which are trademarked/copyrighted or used with permission of the trademark/copyright or logo holder are not in the public domain. These images and logos have been licensed for or used with permission in the materials provided on this website. The materials in the form presented on this website may be used without seeking further permission. Any other use of trademarked/copyrighted images or logos requires permission from the trademark/copyright holder...more

External Web Site Policy This graphic notice means that you are leaving an HHS Web site. For more information, please see the Exit Notification and Disclaimer policy.

 
Contact Us:
  • Centers for Disease Control and Prevention
    1600 Clifton Rd
    Atlanta, GA 30333
  • 800-CDC-INFO
    (800-232-4636)
    TTY: (888) 232-6348
    Contact CDC-INFO
USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Road Atlanta, GA 30329-4027, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO
A-Z Index
  1. A
  2. B
  3. C
  4. D
  5. E
  6. F
  7. G
  8. H
  9. I
  10. J
  11. K
  12. L
  13. M
  14. N
  15. O
  16. P
  17. Q
  18. R
  19. S
  20. T
  21. U
  22. V
  23. W
  24. X
  25. Y
  26. Z
  27. #