 |
 |
 |
 |
|
|
|
|
 |
|
|
 |
|
|
|
|
|
|
|||||||||||||||||
|
|
|
|
|
|
|
|||||||||||
|
|||||||||||||||||
|
|
Erratum Vol. 6, No. 5In the article, "Prevalence of Non-O157:H7 Shiga Toxin-Producing Escherichia coli in Diarrheal Stool Samples from Nebraska," by Paul D. Fey et al., an error occurred in reporting a primer used for amplifying the shiga-toxin gene. The first complete sentence at the top of column 1, page 531, should read, "The following set of primers, which detects both stx1 and stx2, was used: 5' TTTACGATAGACTTCTCGAC 3' and 5' CACATATAAATTATTTCGCTC 3'." We regret any confusion this error may have caused. Erratum Vol. 7, No. 1In the article "Quinolone and Macrolide Resistance in Campylobacter jejuni and C. coli: Resistance Mechanisms and Trends in Human Isolates," there were several errors in Figure 1 on p. 25. The genes should have been referred to as follows: gyrA and parC. In addition, Thr-90 should have been Asp-90. The online version of the article contains the corrected figure. We regret any confusion this error may have caused. Erratum Vol. 7, No. 1In the International Update "Emerging Infectious Diseases in Russia, 1990-1999," by Sergey V. Netesov and J. Lyle Conrad, the area of Russia is given incorrectly. The area should be approximately 17,075,000 km2. We regret any confusion this error may have caused. Home | Top of Page | Current Issue | Expedited | Upcoming Issue | Past Issue | EID Search | Contact Us CDC Home | Search | Health Topics A-Z This page last reviewed July 14, 2001 Emerging Infectious Diseases Journal
|
|
|
|
