A. |
Lysate preparation
(Note that one can often simply boil very fresh growth with good results for DNA extracts).
- With a loop pick up a fair amount of fresh growth (perhaps half of a standard loop-full). Resuspend in 300 ul 0.85% NaCl.
- Heat at 70C for 15 minutes.
- Spin down samples full speed for 2 min in microfuge and pipet out supernatant.
- Resuspend pellet in 50 ul TE (10mM Tris, 1mM EDTA, pH8), 10 ul mutanolysin (3,000 units/ml), and 2 ul hyaluronidase (30 mg/ml, Sigma H-3506; 300-750 units/mg).).
- Incubate 37C, 30 min
- Heat at 100C for 10 min. Proceed immediately with PCR or store lysates at -20C until use.
Occasionally we encounter isolates that are hard to amplify. In these cases we alter lysate preparation as follows:
- Prepare a fresh plate, follow the procedure above.
- After the 15 min at 70C centrifuge it at low speed (5000rpm) for 2 min; then carefully discard supernatant, add 500ul of TE, vortex, centrifuge again at 5000rpm for 2 minutes, discard supernatant and add again 500ul of TE buffer, vortex, and spin at full speed 14000rpm for 2 minutes.
- Add 50ul of TE buffer, 10ul of mutanolysin (and if colonies look very mucoid, 6 uL of hyaluronidase). Proceed with usual lysate preparation protocol after this step.
|
C. |
emm amplicon restriction profiling
We often use amplicon restriction analysis to detect identical patterns and to determine the suitability of the template for sequencing. Additionally, we routinely predict emm types directly from restriction and T agglutination results obtained from temporally and geographically related isolate sets. This strategy must be used very carefully, and based upon an extensive database correlating sequencing results with restriction patterns and T typing results. We now use two different digests ( Dde I and Hinc II + Hae III). Single digests are not always discriminating enough. These two digests always suffice in identifying certain common types such as emm1, emm3, emm12, and emm28. However, for other types sometimes 2 or more restriction profiles are not discriminating enough. For example,
- We have found that type emm102 and emm89 amplicons are not distinguishable using Dde I and Hinc II + Hae III. While emm89 is often associated with T11, and we have never seen sequence type emm102 associated with T11, T13 or T-nontypability can be associated with either emm102 or emm89. In such instances, a third restriction pattern obtained by the use of Mbo I (Sau3a) can be used to distinguish between these 2 types.
- Type emm2 (almost always T2) and emm73 (almost always T13) isolates usually have indistinguishable emm amplicon restriction profiling results with Dde I, Hinc II + Hae III, and Mbo I. To distinguish between emm2 and emm73 isolates expressing unusual T agglutination patterns, in addition to DdeI and Hinc II + Hae III, we use a third digest, Sac I (or Sst I). The emm2 amplicon does not contain this restriction site, while it cleaves at about base 320 of emm73 amplicons.
Dde I digests, Mbo I, Sac I, and Hinc II + Hae III double digests.
- Add 0.25 -0.5ul Dde I, Mbo I, or Sac I (10 unit/ul) to 5 ul unpurified PCR reaction, mix, incubate for at least 40 minutes at 37C. For Hinc II + Hae III double digests add 0.5 uL of BRL buffer 2 and 0.25 ul (10 units/ul) of Hinc II and Hae III prior to mixing and incubation at 37C.
Resolve restriction fragments by electrophoresis on 4% NuSieve 3:1 agarose gel (BioWhittaker) containing 1 ug/ml ethidium bromide next to an appropriate size ladder. If not using band analysis software, be sure to group sets representing isolates of identical T type and OF reaction together. Photograph and note sets with identical restriction profiles of bands usually within the range of about 50 - 800 bp. Although not usually necessary, an option is to also run out gels with undigested PCR fragments for assurance that there is only one major band.
(Note that the presence of additional, weaker bands usually does not affect sequencing results. This may be due to the fact that primer 2, besides annealing to a 3' region in emm, also anneals to an emm -like gene that lies downstream of emm in many GAS strains).
|
D. |
Sequencing
- Prepare sequencing template from 2-11 ul aliquot of PCR prep to be sequenced with ExoSAP-IT as described by USB corporation.
- Dilute BigDye v.1.1 sequencing mixture 1 part BigDye to 5 parts of provided buffer.
- Use PCR product and sequencing primer emm seq2 (tattcgcttagaaaattaaaaacagg) exactly as described in the Applied Biosystems BigDye protocol. For sequencing (we use Perkin Elmer Gene Amp PCR 2400 or 2700 ) we use the following cycling parameters:
25X
96C - 10 sec
55C - 5 sec
60C - 4 min
4C - storage
Store sequencing reactions at -20C. Sequencing reactions can be stored for months at -20C before running on sequencing gel.
Purify sequencing reactions on Quiagen columns, dry, and dissolve in formamide-EDTA exactly as described by manufacturer (in BigDye sequencing handbook) and store at -20C. Alternatively, we have recently started purifying sequencing reactions with good results using Agencourt's paramagnetic bead technology as described in CleanSEQ Reaction Clean-Up. (exit site)
For consultation contact: Bernard Beall, Ph.D. email: BBeall@cdc.gov
|