> PCR Deduction of Pneumococcal Serotypes
PCR Deduction of Pneumococcal Serotypes
Realtime PCR deduction of 21 pneumococcal serotypes or serogroups
- Real time PCR-serotyping oligonucleotides
[PDF - 436KB] (ADDED May 2013) - Triplex sequential real time PCR-serotyping Latin America
[PDF - 135KB] (ADDED May 2013) - Triplex sequential real time PCR-serotyping-US
[PDF - 135KB] (ADDED May 2013) - Triplex sequential real time PCR-serotyping Africa
[PDF - 135KB] (ADDED May 2013) - Triplex sequential real time PCR-serotyping Asia
[PDF - 134KB] (ADDED May 2013)
Conventional PCR deduction of 40 pneumococcal serotypes or serogroups
Accurate serotyping is essential for epidemiologic study of Streptococcus pneumoniae. We have devised simple multiplex PCR schemes to reliably deduce specific pneumococcal serotypes from isolate sets and also from clinical specimens. Overall, we have found this PCR approach to be highly reliable, with the potential to greatly reduce reliance upon conventional serotyping. We feel that this system will give serotype-determining potential to any facility that lacks the expensive typing sera and other reagents needed for conventional serotyping, yet has the modest equipment necessary for DNA amplification and electrophoresis.
When using PCR for deduction of invasive pneumococcal serotypes it is important to realize that the serotype distribution of invasive S. pneumoniae has changed drastically since introduction of the 7 valent conjugate vaccine. See serotype distribution of invasive pneumococcal disease isolates among children <5 years of age, Active Bacterial Core surveillance areas, 2008 vs. 1998-1999
[PPT - 220KB] (Oct 2009). It is important to realize that this figure does not depict disease incidence rate, only cumulative serotype proportions among our total isolates.
See also Serotype-specific IPD in children < 5yrs during 2005-2009, Active Bacterial Core surveillance data
[PPTX - 84KB] (June 2011) .
Relevant publications employing multiplex PCR based serotyping.
- Serotyping Pneumococcal Meningitis Cases in the African Meningitis Belt by Use of Multiplex PCR with Cerebrospinal Fluid
(Njanpop Lafourcade BM et al. J. Clin. Microbiol., Feb 2010; 48: 612 – 614, 2010.) - Molecular detection methods and serotyping performed directly on clinical samples improve diagnostic sensitivity and reveal increased incidence of invasive disease by Streptococcus pneumoniae in Italian children.
(Azzari C et al., J Med Microbiol. Oct;57(Pt 10):1205-12, 2008.) - Identification of serotype in culture negative pneumococcal meningitis using sequential multiplex PCR: implication for surveillance and vaccine design.
(Saha SK et al. PLoS One. 3(10):e3576),2009). - Prevalence of Streptococcus pneumoniae serotype 6C among invasive and carriage isolates in metropolitan Salvador, Brazil, from 1996 to 2007.
(Campos LC et al. Diagn Microbiol Infect Dis. 65:112-115, 2009.) - Rarely occurring 19A-like cps locus from a serotype 19F pneumococcal isolate indicates continued need of serology-based quality control for PCR-based serotype deduction.
(Pimenta FC, et al., J Clin Microbiol. Published online ahead of print. 2009.) - PCR-based quantitation and clonal associations of the current prevalent invasive serogroup 6 pneumococcal serotype, 6C, in the United States: 1999, 2006 – 2007.
(Carvalho MdG, et al., J Clin Microbiol. 47:554-559, 2009.) - Sequential multiplex PCR for determining capsular serotypes of pneumococci recovered from Brazilian children.
(Dias CA, et al., J Med Microbiol. 56:1185-8, 2007.) - Sequential multiplex PCR for identifying pneumococcal capsular serotypes from South-Saharan African clinical isolates.
(Morais L, et al., J Med Microbiol. 56:1181-4, 2007.) - Sequential multiplex PCR for S. pneumoniae serotyping.
(Pai R, et. al., J Clin. Microbiol. 44:124-131, 2006.)
PCR Serotype Deduction Protocols
It is important to realize that although we validate our primer sets thoroughly through using diverse isolate sets representing individual serotypes, we will continue to refine the scheme. This will involve adding serospecificities and updating primer sets to improve specificity. Consult our current updated primer list (40 serospecificities) (see first bullet / link below).
There are 3 important points to keep in mind using this PCR serotyping scheme:
- Band sizes must exactly match those of positive controls before assigning a serotype. We have occasionally detected non-specific bands when multiplex PCR testing clinical specimens.
- The positive pneumococcal control band for cpsA is negative in 1-2% of PCR-serotypeable isolates that we have encountered. We have found this result most often in serotypes 25 and 38, but have also rarely encountered this result for serotypes 14 and 35A. The bottom line is that at present a negative cpsA control does not necessarily equate to a non-serotypeable isolate or a pneumococcus-negative clinical specimen.
- We have recently found a surprisingly high amount of amplification of some of these presumed pneumococcal-specific targets from lytA-negative specimens (therefore presumed pneumococcal negative). For this reason, we now caution that using this assay within carriage specimens may result in some inaccuracy (depending upon specimen and carriage population). Related to this statement are the six 192 bp sequences directly below that correspond to serogroup 10F/10C amplification products (following subtraction of primers). These sequences correspond to non-pneumococcal species and/or lytA-negative carriage specimens. The reason we include these here is the recent rather trivial requirement of GenBank for inclusion of sequences at least 200 bp in length. We have further suggestive data from unknown organisms present in upper respiratory tract specimens, revealing potential non-pneumococcal homologs of additional serogroups and serotypes. This is an ongoing investigation and we will be updating our findings soon. (J Clin Microbiol. 2012 Jul 3: Potential non-pneumococcal confounding of PCR-based determination of serotype in carriage) (July 2012)
>Seq1 [organism =Streptococcus infantis] [strain SS1641] wzx gene, partial CDS
TAGAATATGCTAGGCATCATTTGAAACCTGTCATCTTATTGTTCCTTCCGCAAGTGGCGA
TTTCCTTGTATGTAACGCTAGATCGTACCATGCTTGGAGCCTTAGCTTCTACAAAAGATG
TAGGGATTTATGACCAGGCTCTAAAGTTGGTAAATATCCTTCTGACCTTAGTAACTTCCT
TGGGAAGTGTTA>Seq2 [organism=Streptococcus gordonii] [strain SS1245] wzx gene, partial CDS
TAGAATATGCTAGGCATCATTTAAAGCCGGTCATATTATTATTCCTTCCTCAAGTAGCTA
TTTCTTTGTACATTACGCTGGATCGTACCATGCTTGGAGCCTTAGCTTCTACAAAAGATG
TAGGAATTTATGACCAGGCCCTAAAATTAGTAAATATCCTTCTGACCTTAGTAACTTCCT
TGGGAAGCGTTA>Seq3 [organism=Streptococcus salivarius] [strain SS1061] wzx gene partial CDS
TAGAATATGCTAGGTATCATTTAAAGCCAGTCATATTATTATTCCTTCCTCAAGTAGCTA
TTTCTTTGTACATTACGCTGGATCGTACCATGCTTGGAGCCTTAGCTTCTACAAAAGATG
TAGGGATTTATGACCAGGCCTTAAAATTAGTAAATATCCTTCTGACCTTGGTAACTTCCT
TGGGAAGCGTTA>Seq4 [organism=unknown] [human upper respiratory tract specimen 49] wzx gene, partial CDS
TAGAATATGCTAGACATCATTTAAAGCCGGTCATATTATTATTCCTTCCTCAAGTAGCTA
TTTCTTTATACATTACGCTGGATCGTACCATGCTTGGAGCCTTAGCTTCTACAAAAGATG
TAGGGATTTATGACCAGGCCCTAAAATTAGTAAATATCCTTCTGACCTTGGTAACTTCCT
TGGGAAGCGTTA>Seq5 [organism=unknown] [human upper respiratory tract specimen 248] wzx gene, partial CDS
TAGAATATGCTAGACATCATTTAAAGCCGGTCATATTATTATTCCTTCCTCAAGTAGCTA
TTTCTTTGTACATTACGCTGGATCGTACCATGCTTGGAGCCTTAGCTTCTACAAAAGATG
TAGGGATTTATGACCAGGCCCTAAAATTAGTAAATATCCTTCTGACCTTGGTAACTTCCT
TGGGAAGCGTTA>Seq6 [organism=unknown] [human upper respiratory tract specimen 300] wzx gene, partial CDS
TAGAATATGCTAGACATCATTTAAAGCCGGTCATATTATTATTCCTTCCTCAAGTAGCTA
TTTCTTTGTACATTACGCTGGATCGTACCATGCTTGGAGCCTTAGCTTCTACAAAAGATG
TAGGAATTTATGACCAGGCTCTAAAATTGGTAAATATCCTTCTGACCTTGGTAACTTCCT
TGGGAAGCGTTA
- Oligonucleotide primers used for deducing 40 pneumococcal capsular serotypes
[PDF - 83KB] (UPDATED May 2013) - Fast Extraction of DNA for Streptococcal culture isolates
[PDF - 17KB] (May 2009) - Blood and Body Fluid DNA Extraction for Streptococci
[PDF - 65KB] (UPDATED May 2013)
We have found the following sequential PCR scheme useful for determining pneumococcal serotypes from sterile-site clinical specimens. Please make sure that band sizes exactly match those of positive controls before assigning a serotype, since we have occasionally detected non-specific bands when multiplex PCR testing clinical specimens.
Multiplex PCR for pneumococcal serotype deduction in clinical specimens:
- US clinical specimens
[PDF - 292KB] (UPDATED May 2013) - Latin America clinical specimens
[PDF - 376KB] (UPDATED May 2013) - Africa clinical specimens
[PDF - 563KB] (UPDATED May 2013)
Protocols for identification of pneumococcal serotypes from carriage:
Identification and serotyping of pneumococci from carriage.
[PDF - 40KB] (June 2012)
Streptococcus pneumoniae carriage study protocol ‐ nasopharyngeal (NP) swab processing.
[PDF - 155KB] (March 2010)