CDC en Español

Search:

Streptococcus Laboratory

Home: CDC Streptococcus Lab > Protocols > Alternative MLST Primers for S. pyogenes and S. pneumoniae

Alternative MLST Primers for S. pyogenes and S. pneumoniae

 

Alternative MLST primers. We have found that the primers listed at www.mlst.net (exit site) often lie to close for accurate sequencing results for the first 10-40 bases of the target using our capillary sequencers. We have found these alternative primers useful. These generally lie about 40 bases further upstream and downstream of the target sequences than the ones described at www.mlst.net (exit site).

S. pneumoniae alternative MLST primers.

aroE-fwd TCCTATTAAGCATTCTATTTCTCCCTTC
aroE-rev ACAGGAGAGGATTGGCCATCCATGCCCACACTG

recA-fwd GAATGTGTGATTCAATAATCACCTCAAATAGAAGG
recA-rev TGCTGTTTCGATAGCAGCATGGATGGCTTCC

spi-fwd CGCTTAGAAAGGTAAGTTATGAATTT
spi-rev GAAGAGGCTGAGATTGGTGATTCTCGGCC

xpt-fwd TTAACTTTTAGACTTTAGGAGGTCTTATG
xpt-rev CGGCTGCTTGCGAGTGTTTTTCTTGAG

ddl-fwd TAAAATCACGACTAAGCGTGTTCTGG
ddl-rev AAGTAGTGGGTACATAGACCACTGGG

S. pyogenes alternative MLST primers

gkigas-fwd Length: 24 1 gctgattttgtgggaattggtatg
gkigas-rev Length: 23 1 gtgagcgtagaaattctcctgct

gtr-fwd Length: 26 1 ggaattgatttagacattatgccagg
gtr-rev Length: 22 1 cacaataacgccgccatccata

recpgas-fwd Length: 22 1 tgtccgcaccctatcaatggat
recgas-rev Length: 24 1 catctttcacaaggatatgttgcc

xptgas-fwd Length: 29 1 atgcagttacttgaagaacgcatcttaac
xptgas-rev Length: 24 1 gcctccaagaagtttagattacca

yqi-fwd Length: 27 1 cttttgcaggttatcacatgggtataa
yqi-rev Length: 27 1 aagcaatagctcctccattg acattaa

muri-fwd Length: 28 1 ctatggtcctagacccaaaaaacaaatt
muri-rev Length: 25 1 ggatttgctgttgtaaaaaagcggt

muts-fwd Length: 22 1 aggtcagatgttagaggctagg
muts-rev Length: 27 1. cccagttcatcaaatagaataagagag

Primers for Streptococcus dysgalactiae subsp. equisimilis and Streptococcus canis MLST.

Note that all primers, with the exception of yqiZ, target genes corresponding to the S. pyogenes MLST scheme described at http://spyogenes.mlst.net/.

Primer name

sequence

amplicon
length (bp)

gki-fwd
gki-rev

GCAGATTTTATTGGTATCGGTATGG
GTGAACGTAAGAATTCTCCTGCTG

498

gtr-fwd
gtr-rev

GGAATTGATTTAAACATTATGTCAGGAG
CACAATAACGCCGCCATCCATA

450

murI-fwd
murI-rev

TTATGGTCCAAGACCTGCTGAGC
TTTCAGGACTTGCCGTTGTGTAAAA

438

mutS-fwd
mutS-rev

AGGTCAGATGTTAGAGGCTAGG
CCTAGTTCATCAAATAGAATAAGGGAA

405

recP-fwd
recP-rev

TGTCCGCACCCTATCAATGGAT
CATCTTTCACAAGGATATGTTGCC

459

xpt-fwd
xpt-rev

ATGCAGTTACTTGAAGAACGCATCTTAAC
GCCTCCAAGAAGTTTAGATTACCA

450

yqiZ-fwd
yqiZ-rev

CAGATGCTTTTAACAATTACCACATGG
CCCATTCACATTCACGATTTCTGG

434

 

Back to Top
Page last modified: January 20, 2009
Content source: National Center for Immunization and Respiratory Diseases
  • Email this page

Contact CDC

English and Spanish
(800) CDC-INFO
(800) 232-4636
TTY: (888) 232-6348
FAX: (770) 488-4760
Contact CDC-INFO

International Travel
Phone: 1-887-394-8747

Safer Healthier People

Centers for Disease Control and Prevention, 1600 Clifton Rd, Atlanta, GA 30333, U.S.A
Public Inquiries: 1-800-CDC-INFO (232-4636) / 1-888-232-6348 (TTY)