Table of Contents

Locator Record

Title: Partial Hepatitis C Virus RNA Sequences Isolated from Individuals (SSNH3HCV )
Contact Number: 1-866-441-NCHS
Years of Content: 1988 - 1994
First Published: August, 2012
Revised: NA
Access Constraints: None
Use Constraints: None
Geographic Coverage: National
Subject:Partial Hepatitis C Virus RNA Sequences Isolated from Individuals
Record Source: NHANES 1988 - 1994
Survey Methodology: NHANES 1988 - 1994 is a stratified multistage probability sample of the civilian non-institutionalized population of the U.S.
Medium: NHANES Web site; SAS transport files

Component Description

Stored sera from a population of individuals, who tested positive for hepatitis C infection as part of the NHANES III (1988-1994) survey, were analyzed for the presence of hepatitis C virus (HCV) RNA. The HCV RNA was isolated and sequenced either to determine the genotype of the isolated virus or to determine the viral quasispecies diversity within an infected individual.

Eligible Sample

All Individuals (both male and female, age 6+), from the NHANES III survey, who were determined to be HCV positive according to the standard NHANES III HCV testing protocol and were determined to have detectible levels of HCV RNA.

Description of Laboratory Methodology

Sequencing for genotyping was done as documented in: Nainan et al., 1996; Alter et al., 1999 and Nainan et al., 2006. Sequencing for quasispecies analysis was done using the method described by Ramachandran et al., 2008. The primers used are listed below in Appendix A.

The nested PCR primers used to isolate HCV sequences were designed and manufactured within CDC. All other reagents were obtained from commercial vendors.

Data Processing and Editing

HCV sequence contigs were aligned and edited by hand using DNAstar to construct the final sequence for each isolate.

The primers used are described and listed in the Appendix A below. Due length of the sequences, data is available in text files to avoid truncation.

SEQN: Respondent sequence number

ISEQ: Isolated sequence
This variable denotes the sequence that has been isolated for each participant.

IDENT: Number of additional quasispecies isolates
In some PCR reactions multiple sequences have identical nucleotide sequences, for example if five PCR products have identical sequences a 5 will be found in this column. 1 denotes unique sequences. 0 denotes a consensus sequence with no quasispecies analysis.

QSID: Quasispecies ID number
If quasispecies analysis was conducted, individual quasispecies will be labeled with their identification numbers. 0 denotes a consensus sequence with no quasispecies analysis. 

Data set names and corresponding variables are as follows:

 

NHIII Data Sets and Variables
Sequences NHANES III Data Set and Variables
NS5b sequences NH3NS5b
NHANES specimen number (n=270) SEQN
Quasispecies nucleotide sequence (n=540) ISEQ
5’ UTR sequences NH35UTR
NHANES specimen number (n=272) SEQN
Quasispecies nucleotide sequence (n=272) ISEQ
NS5a sequences NH3NS5a
NHANES specimen number (n=12) SEQN
Quasispecies identification number QSID
Quasispecies nucleotide sequence (n=343) ISEQ
HVR1 sequences NH3HVR1
NHANES specimen number (n=108) SEQN
Quasispecies identification number QSID
Number of quasispecies with this sequence IDENT
Quasispecies nucleotide sequence (n=2305) ISEQ

Laboratory Quality Assurance and Monitoring

HCVRNA:

Hepatitis C RNA: Testing for HCV RNA by reverse-transcriptase ¬polymerase-chain reaction (RT-PCR) amplification of the 5' noncoding region was performed on anti-HCV positive samples. Samples found to be negative for HCV RNA were extracted a second time by the same procedure with an additional incubation at 50 degrees Celsius for 45 minutes with 25 units of reverse transcriptase (Boehringer Mannnheim, Inndianapolis) and 10 units of RNAsin (Boehringer Mannnheim).

References

Appendix A

Region: Region amplified
PCR products were generated from four regions on the HCV genome; 5’-untranslated region (5’UTR), the hypervariable region 1 (HVR1), non-structural gene 5a (NS5a) and non-structural gene 5b (NS5b).

Primer Name: Primer Name
the primer name

Direction: Direction of transcription
transcription from 5’ to 3’ (Forward), transcription from 3’ to 5’ (Reverse)

Position: Nested primer position
The initial PCR reaction amplifies a region of the HCV genome (External primers). A subsequent PCR reaction amplifies an internal region from the initial reaction (Internal primers).

Subtype: List of subtype primers
Many of these primers amplify across all HCV subtypes. Some subtypes require specifically tailored primers.

Sequence: Primer nucleotide sequence (5’->3’)
5’-3’ nucleotide sequence for each primer.

 

Primers
Region Primer Name Direction Position Subtype 5'-3' NT Sequence for Nested PCR
5'UTR UTR-A295 Reverse Internal N/A CAAGCACCCTATCAGGCAGT
5'UTR UTR-A329 Reverse External N/A TGGTGCACGGTCTACGAGAC
5'UTR UTR-F13 Forward Internal N/A GAAAGCGTCTAGCCATGGCGT
5'UTR UTR-F15 Forward External N/A CTGTGAGGAACTACTGTCT
HVR1 HVR1-1295F1 Forward External N/A TGGCTTGGGATATGATGATGAACT
HVR1 HVR1-1302F2 Forward Internal N/A GGATATGATGATGAACTGGT
HVR1 HVR1-1610R2 Reverse Internal N/A ATGTGCCAGCTGCCGTTGGTGT
HVR1 HVR1-1619R1 Reverse External N/A GCAGTCCTGTTGATGTGCCA
NS5a HCV1A-6941F Forward External 1a TCCATGCTCACTGATCCCTCCCATAT
NS5a HCV1A-6952F Forward Internal 1a TGATCCCTCCCATATAACAGCAGA
NS5a HCV1A-7643R Reverse Internal 1a GACCATGACCCGTCGCTGAGAT
NS5a HCV1A-7654R Reverse External 1a CTCACTACTGACCGTCGACCAAGA
NS5a HCV1B-6941F Forward External 1b ATGCTTACCGACCCCTCCCACAT
NS5a HCV1B-6960F Forward Internal 1b CATTACAGCAGAGACGGCTAAGCGTA
NS5a HCV1B-7643R Reverse Internal 1b TAGACCAAGACCCGTCGCTGA
NS5a HCV1B-7654R Reverse External 1b CTCCTCGCTCACGGTAGACCAAGA
NS5a HCV2A-6941F Forward External 2a GTCCATGCTAACAGATCCATCCCATA
NS5a HCV2A-6946F Forward Internal 2a GCTAACAGATCCATCCCATATCAC
NS5a HCV2A-7643R Reverse Internal 2a TCTACCTGCTCAGGCTCCAGGTCT
NS5a HCV2A-7654R Reverse External 2a GGAGGTTGAAGCTCTACCTGCTCA
NS5a HCV3A-6941F Forward External 3a GATGTTGAGAGACCCTTCCCATATCA
NS5a HCV3A-6945F Forward Internal 3a TTGAGAGACCCTTCCCATATCA
NS5a HCV3A-7643R Reverse Internal 3a TGGACCAAGAGTCGCAACTCAAGT
NS5b NS5B-122 Forward Internal N/A CTCAACCGTCACTGAGAGAGACAT
NS5b NS5B-K1 Forward External N/A TGGGGATCCCGTATGATACCCGCTGCTTTGA
NS5b NS5B-K2 Reverse External N/A GGCGGAATTCCTGGTCATAGCCTCCGTGAA
NS5b NS5B-R1 Reverse Internal N/A GCTCTCAGGCTCGCCGCGTCCTC