Title: Partial Hepatitis C Virus RNA Sequences Isolated from Individuals
(SSNH3HCV
)
Contact Number: 1-866-441-NCHS
Years of Content: 1988
- 1994
First Published: August, 2012
Revised:
NA
Access Constraints: None
Use Constraints: None
Geographic Coverage: National
Subject:Partial Hepatitis C Virus RNA Sequences Isolated from Individuals
Record Source: NHANES 1988
- 1994
Survey Methodology: NHANES 1988
- 1994
is a stratified multistage probability sample of the civilian non-institutionalized population of the U.S.
Medium: NHANES Web site; SAS transport files
Stored sera from a population of individuals, who tested positive for hepatitis C infection as part of the NHANES III (1988-1994) survey, were analyzed for the presence of hepatitis C virus (HCV) RNA. The HCV RNA was isolated and sequenced either to determine the genotype of the isolated virus or to determine the viral quasispecies diversity within an infected individual.
All Individuals (both male and female, age 6+), from the NHANES III survey, who were determined to be HCV positive according to the standard NHANES III HCV testing protocol and were determined to have detectible levels of HCV RNA.
Sequencing for genotyping was done as documented in: Nainan et al., 1996; Alter et al., 1999 and Nainan et al., 2006. Sequencing for quasispecies analysis was done using the method described by Ramachandran et al., 2008. The primers used are listed below in Appendix A.
The nested PCR primers used to isolate HCV sequences were designed and manufactured within CDC. All other reagents were obtained from commercial vendors.
HCV sequence contigs were aligned and edited by hand using DNAstar to construct the final sequence for each isolate.
The primers used are described and listed in the Appendix A below. Due length of the sequences, data is available in text files to avoid truncation.
SEQN: Respondent sequence number
ISEQ: Isolated sequence
This variable denotes the sequence that has been isolated for each participant.
IDENT: Number of additional quasispecies isolates
In some PCR reactions multiple sequences have identical nucleotide sequences, for example if five PCR products have identical sequences a 5 will be found in this column. 1 denotes unique sequences. 0 denotes a consensus sequence with no quasispecies analysis.
QSID: Quasispecies ID number;
If quasispecies analysis was conducted, individual quasispecies will be labeled with their identification numbers. 0 denotes a consensus sequence with no quasispecies analysis.
Data set names and corresponding variables are as follows:
| Sequences | NHANES III Data Set and Variables |
|---|---|
| NS5b sequences | NH3NS5b |
| NHANES specimen number (n=270) | SEQN |
| Quasispecies nucleotide sequence (n=540) | ISEQ |
| 5’ UTR sequences | NH35UTR |
| NHANES specimen number (n=272) | SEQN |
| Quasispecies nucleotide sequence (n=272) | ISEQ |
| NS5a sequences | NH3NS5a |
| NHANES specimen number (n=12) | SEQN |
| Quasispecies identification number | QSID |
| Quasispecies nucleotide sequence (n=343) | ISEQ |
| HVR1 sequences | NH3HVR1 |
| NHANES specimen number (n=108) | SEQN |
| Quasispecies identification number | QSID |
| Number of quasispecies with this sequence | IDENT |
| Quasispecies nucleotide sequence (n=2305) | ISEQ |
HCVRNA:
Hepatitis C RNA: Testing for HCV RNA by reverse-transcriptase ¬polymerase-chain reaction (RT-PCR) amplification of the 5' noncoding region was performed on anti-HCV positive samples. Samples found to be negative for HCV RNA were extracted a second time by the same procedure with an additional incubation at 50 degrees Celsius for 45 minutes with 25 units of reverse transcriptase (Boehringer Mannnheim, Inndianapolis) and 10 units of RNAsin (Boehringer Mannnheim).
| Region | Primer Name | Direction | Position | Subtype | 5'-3' NT Sequence for Nested PCR |
|---|---|---|---|---|---|
| 5'UTR | UTR-A295 | Reverse | Internal | N/A | CAAGCACCCTATCAGGCAGT |
| 5'UTR | UTR-A329 | Reverse | External | N/A | TGGTGCACGGTCTACGAGAC |
| 5'UTR | UTR-F13 | Forward | Internal | N/A | GAAAGCGTCTAGCCATGGCGT |
| 5'UTR | UTR-F15 | Forward | External | N/A | CTGTGAGGAACTACTGTCT |
| HVR1 | HVR1-1295F1 | Forward | External | N/A | TGGCTTGGGATATGATGATGAACT |
| HVR1 | HVR1-1302F2 | Forward | Internal | N/A | GGATATGATGATGAACTGGT |
| HVR1 | HVR1-1610R2 | Reverse | Internal | N/A | ATGTGCCAGCTGCCGTTGGTGT |
| HVR1 | HVR1-1619R1 | Reverse | External | N/A | GCAGTCCTGTTGATGTGCCA |
| NS5a | HCV1A-6941F | Forward | External | 1a | TCCATGCTCACTGATCCCTCCCATAT |
| NS5a | HCV1A-6952F | Forward | Internal | 1a | TGATCCCTCCCATATAACAGCAGA |
| NS5a | HCV1A-7643R | Reverse | Internal | 1a | GACCATGACCCGTCGCTGAGAT |
| NS5a | HCV1A-7654R | Reverse | External | 1a | CTCACTACTGACCGTCGACCAAGA |
| NS5a | HCV1B-6941F | Forward | External | 1b | ATGCTTACCGACCCCTCCCACAT |
| NS5a | HCV1B-6960F | Forward | Internal | 1b | CATTACAGCAGAGACGGCTAAGCGTA |
| NS5a | HCV1B-7643R | Reverse | Internal | 1b | TAGACCAAGACCCGTCGCTGA |
| NS5a | HCV1B-7654R | Reverse | External | 1b | CTCCTCGCTCACGGTAGACCAAGA |
| NS5a | HCV2A-6941F | Forward | External | 2a | GTCCATGCTAACAGATCCATCCCATA |
| NS5a | HCV2A-6946F | Forward | Internal | 2a | GCTAACAGATCCATCCCATATCAC |
| NS5a | HCV2A-7643R | Reverse | Internal | 2a | TCTACCTGCTCAGGCTCCAGGTCT |
| NS5a | HCV2A-7654R | Reverse | External | 2a | GGAGGTTGAAGCTCTACCTGCTCA |
| NS5a | HCV3A-6941F | Forward | External | 3a | GATGTTGAGAGACCCTTCCCATATCA |
| NS5a | HCV3A-6945F | Forward | Internal | 3a | TTGAGAGACCCTTCCCATATCA |
| NS5a | HCV3A-7643R | Reverse | Internal | 3a | TGGACCAAGAGTCGCAACTCAAGT |
| NS5b | NS5B-122 | Forward | Internal | N/A | CTCAACCGTCACTGAGAGAGACAT |
| NS5b | NS5B-K1 | Forward | External | N/A | TGGGGATCCCGTATGATACCCGCTGCTTTGA |
| NS5b | NS5B-K2 | Reverse | External | N/A | GGCGGAATTCCTGGTCATAGCCTCCGTGAA |
| NS5b | NS5B-R1 | Reverse | Internal | N/A | GCTCTCAGGCTCGCCGCGTCCTC |