|
|
Letter
Parachlamydiaceae
as Rare Agents of Pneumonia
Gilbert Greub,* Pierre Berger,* Laurent Papazian,† and Didier Raoult*
*Université de la Méditerranée, Marseille, France; and †Hôpital Sainte
Marguerite, Marseille, France
Suggested citation for this article: Greub G,
Berger P, Papazian L, Raoult R. Parachlamydiaceae as rare agents
of pneumonia. Emerg Infect Dis [serial online] 2003 Jun [date cited].
Available from: URL: http://www.cdc.gov/ncidod/EID/vol9no6/02-0615.htm
To the Editor: Members of the Parachlamydiaceae family
are emerging intracellular bacteria living in amoebae (1,2).
Serologic studies have suggested that Parachlamydia acanthamoeba
might be an agent of community-acquired pneumonia transmitted from a water
source (3,4). In a single occasion, 16s rRNA of a member
of the Parachlamydiaceae family was amplified and sequenced from
a bronchoalveolar lavage sample (5). Thus, to specify
the role played by the Parachlamydiaceae as agents of lower respiratory
tract infection, we developed a real-time polymerase chain reaction (PCR)
assay and applied it to 1,200 bronchoalveolar lavage samples, taken mainly
from patients with pneumonia of unknown cause and received in our diagnostic
microbiology laboratory between 1997 and 2002.
DNA extraction was performed by using the MagNA Pure LC instrument and
the MagNA Pure LC DNA Isolation Kit III (Roche Molecular Biochemicals,
Mannheim, Germany). Real-time PCR was performed by using TaqMan technology
and targeting the gene encoding for a nonmitochondrial ATP/ADP translocase
(GenBank accession no. AF490592). This energy parasite gene is present
only in rickettsiae, chlamydiae, and plant plastids (6).
The master mixture was prepared from the TaqMan Universal Master Mix kit
(Applied Biosystems, Foster City, CA), according to the manufacturer’s
instructions, and included 200 nM of each primer (Adp81F 5'- TAGTGATCTGCTACGGGATTT,
Adp84R 5'-TTGGATTAGGATATTGCAATTT) and 200 nM of the fluorescent labeled
probe (6-FAM-5'-AACCTTGTAGAAGTAACCTGGAAGAACCAGC-3'-TAMRA, where 6-FAM
is 6-carboxyfluorescein and TAMRA is 6-carboxytetramethylrhodamine). Amplification
was carried out on the ABI 7700 sequence detection system (TaqMan system,
Applied Biosystems), by running 45 cycles, with annealing temperature
of 52°C and polymerization temperature of 60°C. To prevent carryover,
200 µM of uracil triphosphate was part of the master mixture, and uracil-N-glycosylase
was used systematically. Parachlamydia acanthamoeba strain Hall
coccus (kindly provided by T.J. Rowbotham) (3) and sterile
water were used as positive and negative controls, respectively. In addition,
PCR was tested on Chlamydophila pneumoniae and Chlamydia psitacci
and four strains of Rickettsia. All but one (Rickettsia montana)
was negative, as were 64 sterile water controls.
Of the 1,200 bronchoalveolar lavage samples tested, 5 (0.42%) were positive.
When PCR was repeated for those five samples, four were negative for P.
acanthamoeba DNA, and only one was a true positive, confirmed by sequencing
the product of the additional PCR. The sequence shared 100% DNA homology
with P. acanthamoeba strain Hall coccus (GenBank accession no.
AF490592). The patient, a 31-year-old man who was HIV-positive, had pneumonia,
cough, and no fever. Chest x-ray examination showed an opacity in the
right lung and a bilateral infiltrate. Leukocyte count was 5,000/mm3
with 80 CD4 cells/mm3; microbiologic investigations (in which
the bronchoalveolar lavage was examined for cytomegalovirus, Chlamydophila
pneumoniae, Legionella pneumophila, Pneumocystis carinii,
mycobacteria, and Toxoplasma gondii)did not identify a causal agent.
We developed a highly sensitive PCR, which could amplify as few as 10
bacteria. The assay results in a relatively high specificity (1,195/1,199;
99.67%) because it uses a target gene found only in Rickettsiae,
Chlamydiae, and plant plastids, and uses a specific DNA probe.
We considerably decreased the risk of horizontal and vertical contamination
of the PCR reaction by using uracil and uracil-N-glycosylase and by keeping
reaction cups closed since the first amplification cycle.
More importantly, our study showed that Parachlamydia DNA is rarely
found in bronchoalveolar lavage samples (0.083%). This suggests that persons
are infrequently exposed to Parachlamydia organisms and, consequently,
members of the Parachlamydiaceae seldom cause pneumonia in humans.
In the only positive sample, whether Parachlamydia originated from
bacteria in the oropharynx, from water, or from a colonization of the
lower respiratory tract was not known; whether they caused the patient’s
pneumonia is also not known. That two strains of Parachlamydia
found in amoebae were recovered from the nasopharynx of healthy volunteers
(7) favors the first hypothesis. However, that the positive
broncholaveolar lavage specimen was taken from an HIV-positive patient
with community-acquired pneumonia suggests that Parachlamydia might
occasionally play a pathogenic role in AIDS patients. Moreover, any amoebae-associated
bacteria should be considered as a potential emerging pathogen because
intra-amoebal growth may lead to the selection of virulence traits and
to the adaptation to professional phagocytes, such as alveolar macrophages
(1,2). Further studies are warranted to determine whether
Parachlamydiaceae causes community-acquired pneumonia, particularly
in HIV-infected persons.
Acknowledgments
We thank the Swiss National Science Foundation for
funding the postodoctoral fellowship of Gilbert Greub in the Unité des
Rickettsies, Marseille, France, and Olivier Castigliola for technical
assistance.
References
- Greub G, Raoult D. Parachlamydiaceae,
potential emerging pathogens. Emerg Infect Dis 2002;8:625–30.
- Greub G, Raoult D. Crescent
bodies of Parachlamydia acanthamoeba and its life cycle within
Acanthamoeba polyphaga: an electron micrograph study. Appl
Environ Microbiol 2002;68:3076–84.
- Birtles RJ, Rowbotham TJ, Storey C, Marrie TJ, Raoult D. Chlamydia-like
obligate parasite of free-living amoebae. Lancet 1997;349:925–6.
- Marrie TJ, Raoult D, La Scola B, Birtles RJ, de Carolis E. Legionella-like
and other amoebal pathogens as agents of community-acquired pneumonia.
Emerg Infect Dis 2001;7:1026–9.
- Corsaro D, Venditti D, Le Faou A, Guglielmetti P, Valassina M. A
new chlamydia-like 16s rDNA sequence from a clinical sample. Microbiology
2001;147:515–6.
- Wolf YI, Aravind L, Koonin EV. Rickettsiae
and chlamydiae evidence of horizontal gene tranfer and gene exchange.
Trends Genet 1999;15:173–5.
- Amann R, Springer N, Schonhuber W, Ludwig W, Schmid EN, Muller KD,
et al. Obligate
intracellular bacterial parasites of Acanthamoebae related to
Chlamydia spp. Appl Environ Microbiol 1997;63:115–21.
|
